Introduction
The genome of onion is yet to be sequenced
due to its large and repetitive genome (~16.35 Gbp).
Chromosome structural analysis can assist in studies of the large genome,
showing the nature and locations of major repetitive DNA families, such as telomeric, sub-telomeric, centromeric, and ribosomal rDNA,
including dispersed repetitive and satellite DNA sequences. Understanding the
range and nature of variation in a small number of repetitive DNA sequence is
valuable to understand genome relationships and chromosome evolution in the
many species with complex and large genomes, such as the genus Avena (Katsiotis et al. 2000; Liu et al. 2019), where there is as yet no complete DNA sequence
Available. Furthermore, chromosomal recombination and genome stability can be
assessed efficiently using both genomic and repetitive DNA probes within germplasm pools and wild relatives of cultivated species
such as Arachis (Nascimento
et al. 2018).
Most
eukaryotic chromosomes end with a specialized repetitive DNA sequence, the
telomere. The term was introduced by Müller
(1938) and used by McClintock (1941) in maize as the terminal element of the
chromosomes that caps the chromosome, enables replication of the full length,
and inhibits end-joining, ensuring stability of the genome (Siroky et al. 2003). The terminal
regions of plant chromosomes, internal to the true telomere, often contain
repetitive DNA motifs, likely to relate to genome stability and packaging (Vershinin et al.
1995). The true terminal telomeric sequences are
added by an enzyme including an RNA template to chromosome ends, rather than by
semi-conservative replication (Watson et al. 2010).
Most plant
species are similar to Arabidopsis in
having a telomeric repeat comprised of
7 nucleotides (5′-TTTAGGG-3′) (Richards and Ausubel 1988), while most
animal species have a six-nucleotide repeat (O'Connor 2008)
occurring in arrays from 10 kb (human) to 150
kb (mice), and 2–5 kb in plants (Arabidopsis thaliana) (Riha et al. 1998), to more than 100 kb in barley (Hordeum vulgare) and tobacco (Nicotiana tabacum) (Kilian et al.
1995; Schwarzacher and Heslop-Harrison
1991). Cuadrado et
al. (2009) while studying non-denaturing FISH (ND-FISH) on different
species of cereals observed the brighter telomeric
signal with shorter repeat sequences as compared to species with high repeat
sequences. Dysfunctional telomeres, reduction or unavailability of the telomere
leads to massive instability in the genome of crop plant (Siroky
et al. 2003). Fuchs et
al. (1995) showed that chromosomes in some Amaryllidaceae
species, particularly in Allioideae group, did not
terminate with the 7 bp repeat of other plant
species. There was speculation about the nature of the chromosome termini, including the stabilization of chromosome ends by
amplification of mobile elements, of satellite DNA (such as a 375 bp repeat found near the ends of Allium chromosomes, Barnes et
al. 1985) and rDNA (Pich
et al. 1996; Pich
and Schubert 1998). It is now clear that Allium telomeres consist of the unusual telomeric sequence (CTCGGTTATGGG)n, synthesized
and added to the ends of chromosomes by a different telomerase from those found
in most plant species (Fajkus et al. 2016). Many other repetitive DNA sequence can also be useful
to identify chromosomes and genomic variation (Kubis et al. 1997).
The aim of
the current study was to use fluorescent staining and in situ hybridization methods to generate a karyotype and to assess
the presence of DNA sequences with simple FISH (involving heat denaturation of
the chromosomal DNA to make it single-stranded) and FISH with no specific step
to make the chromosomal DNA single-stranded, termed non-denaturing (ND-) FISH
in A. cepa.
Tandemly repeated satellite DNA repeats and 45S rDNA were used as probes. By this study we will also
confirm the usefulness of ND-FISH in plant cytogenetics.
ND-FISH can be effective and fast, of value for genome analysis in species with
very large genomes.
Materials and Methods
Plant
material
The seeds of twelve diverse accessions of cultivated
onions were obtained from Magnus Kahl Seeds (MKS)
Pakistan and commercial seed source in Pakistan. The seed were germinated to
collect roots for mitotic chromosome preparation and young leaf tissues used
for extraction of DNA for amplification of genes to be used for probe development
for FISH analysis.
Mitotic
chromosome preparation
Fig. 1: PCR amplification results of (a) sub-telomeric
satellite DNA, (b) 45S rDNA
amplified from A. cepa
Young roots (~ 1.5 to 2.0 cm) from different accessions
of onion were collected in 1.5 mL Eppendorf tubes
containing drinking water. These roots were immediately shifted into a
container pressurized by Nitrous Oxide (N2O) for around 50 min as a
pre-treatment to get good metaphase index followed by fixation in freshly
prepared ethanol : acetic acid (3:1) Solution. The
root tips were then subjected to enzymatic digestion (cellulase
@ 20U/mL and pectinase @ 20U/mL diluted in 1x enzyme buffer solutions) for
around 35 min in at 37℃. Mitotic chromosome preparation was carried out
by following the methodology of Schwarzacher and Heslop-Harrison (2000).
DNA
extraction and probe development
DNA extraction was performed by the CTAB method (Doyle and Doyle 1990) from fresh onion leaves. The extracted DNA was
further used in amplification of telomeric tandem
repeats (314 bp), telomeric
satellite DNA (375 bp) and 18S rDNA
gene (1.1 kb).
The sub-telomeric tandem repeat sequence pAc074 with a sequence ID # AF227152.1 (https://www.ncbi.nlm.nih.gov/nuccore/AF227152.1/)
initially reported by Do et al. (2001) was used as probe for ND-FISH
analysis based on the sequence of
pAc074. An oligo-nucleotide probe, named Oligo-pAc074
of 59bp sequences (5ʹ-GACATCGATTATTCGGACGGCCATAACTGTTGCCTCGTTTAGAGTTACGGGAGCCATAA
-3ʹ) was synthesized and 5ʹ labeled with 6-carboxyfluorescein
(6-FAM) (Shanghai Invitrogen Biotechnology Co., Ltd., Shanghai, China). The oligo-nucleotide probes Oligo-5SrDNA
(TCAGAACTCCGAAGTTAAGCGTGCTTGGGCGAGAGTAGTAC) and Oligo-18SrDNA
(GACGGGCGGTGTGTACAAAGGGCAGGGACGT) for targeting 5S rDNA
and 18S rDNA in Allium
were synthesized. The sequences of Oligo-5SrDNA were partially homologous to
the last part of the Allium cepa gene for 5S rRNA clone pAc5S-15 (NCBI gene bank number AB056586, Hizume
et al. 2002). Primers were designed
using sequence of telomeric satellite DNA repeats
having sequence ID # X02573.1 (https://www.ncbi.nlm.nih.gov/nuccore/X02573.1/)
of cultivated onion reported by Barnes et al. (1985). Briefly, to
amplify the fragment through PCR, a pre-denaturation was done for 4 min at 95°C
followed by 30 cycles of denaturation at 95℃ for 45 s, annealing of
primers at 59°C for 40 s, extension for 1 min at 72°C before final extension at
72°C for 10 min. The
amplified DNA product from A. cepa L. (Fig. 1a) was then labeled with biotin-11-dUTP by random
priming (Roche, Diagnostics,
Basel, Switzerland)
and used as telomeric satellite probes. For 45S rDNA
a gene sequence of 18S rDNA (1.1 kb) was amplified
from A. cepa
L. (Fig. 1b) using a pair of primer P1:5´ CGAACTGTGAAACTGCGAATGGC-3´ and
P2:5´-TAGGAGCGACGGGCGGTGTG-3´desigend by Chang et al. (2010). PCR
condition for 45S rDNA, was with an initial
denaturation at 95°C for 4 min followed by 30 cycles of amplification -
denaturation at 95°C for 45 s, annealing of primers at 55°C for 40 s, DNA
extension at 72°C for 1 min, and a final extension at 72°C for 10 min. Amplified product was then
purified and labelled with digoxigenin-16-dUTP
according to manufacturer’s instruction (Roche, Germany) and used as a probe to
localize 45S rDNA sites.
In situ
hybridization
The prepared slides with good metaphase index were
selected and re-fixed in ethanol: acetic acid (3:1) followed by RNase treatment (100 µg/mL) for 1hr at
37°C followed by a wash with 2x SSC. The slides were incubated with HCl (0.01N) followed by pepsin treatment (0.05 µg/mL). Application
of paraformaldehyde was done for 10 min followed by a wash with 2x SSC. The
slides were then dehydrated with a series (70, 85 and 90%) of ethanol for two
min each. Hybridization mixture (50% formamide, 2x
SSC, 10% dextran sulphate, 0.025 µg/mL salmon sperm
DNA, 1.25 mM EDTA, 0.125% SDS and probes) was
denatured at 85°C for 7 min and placed in ice for 10 min. About 40 µL of hybridization
mixture was applied to each slide and covered with plastic cover slip. Slides
were then shifted to a hybridization chamber and denaturation of chromosomes
was performed for 6 min at 70°C before cooling to allow hybridization overnight
at 37°C. The slides were removed from hybridization chamber and washings were
performed with 2x SSC, 0.1x SSC for 12 min and in detection buffer for 5 min.
Hybridization site detection was performed with FITC-antidigoxigenin
for digoxigenin labelled
probe and streptavidin-alexa-594 was used for biotin-labelled
probes. For the detection of physical localization of synthesized
Oligo-pAc074 on onion chromosomes, the protocol of non-denaturing FISH (ND-FISH) was
employed as described by Lang et al. (2019), similar to the above
procedure but without the 70°C step. After post-hybridization washes,
counterstaining of whole chromosomes was performed with 4', 6-diamidino-2-phenylindole (DAPI) and slides were
mounted in Vectashield. The slides were analyzed on
Nikon Eclipse N80i fluorescent microscope equipped with a DS-QiMc monochromatic camera (Nikon, Japan) and appropriate
filter set. Adobe Photoshop cc was used to process the images.
Individual
chromosome lengths were measured using ImageJ
software. The chromosome analysis was performed by the classification system
proposed by Levan et al.
(1964). On the basis of arm ratios,
chromosomes were further subdivided into four different classes (Adonina et al.
2015; Malik and Srivastava
2009) and homology of chromosomes were assigned by centromeric
positions and length similarities (Gomez-Rodriguez
et al. 2013).
Results
Chromosome
characterization and analysis
Chromosome preparations were arranged on the basis of
chromosome arm length and arm ratios by measuring long and sort arm of five
randomly selected metaphases and taking the averages of these values. The arm
ratios were calculated by dividing value of long arm to short arm. The eight
pairs of chromosomes were arranged in decreasing length order (Fig. 2e and
Table 1). The chromosomes formula for onion is 2n = 2x = 2 m + 2 m + 2 m + 2 m
+ 2 m +2st45s rdna + 2 m + 2 sm45s rdna.
ND-FISH
for sub-telomeric tandem repeat and repetitive DNA sequences
ND-FISH by
using labelled probe Oligo-pAc074 representing a sub-telomeric tandem
repeat sequence in different accessions of cultivated onion produced strong
signal strength on almost all onion chromosomes (Fig. 3). The ND-FISH signals by Oligo-pAc074 (Fig. 3) are similar to denaturing FISH results obtained by telomeric satellite DNA repeats (accession no. X02573.1;
Fig. 4). There were two termini where signals were absent on the short arm of
chromosome 6 (red arrows, Fig. 2a, b, c, d). On
one terminal region of chromosome 8, the signal was weak (green arrows, Fig.
2a, b), or under detection limit on the other homologue of chromosome 8 in
different accessions of onion (white arrows, Fig. 2c, d). ND-FISH was also performed for identification of signals for 5S and 45S rDNA. Table 1: Chromosome analysis of Allium cepa hybridize
with sub-telomeric satellite DNA, 5S rDNA and 45S rDNA
Chromosome
number |
Mean chromosome length (µm) |
Arm ratio |
Chromosome type |
FISH results |
|||||
Short arm |
Long arm |
Total length |
5S rDNA |
45S rDNA |
Telomeric repeats |
||||
Short arm |
Long arm |
||||||||
1 |
7.60 |
10.64 |
18.24 |
1.40 |
m |
- |
- |
+ |
+ |
2 |
6.45 |
10.42 |
16.87 |
1.62 |
m |
- |
- |
+ |
+ |
3 |
5.63 |
9.16 |
14.79 |
1.63 |
m |
- |
- |
+ |
+ |
4 |
6.35 |
8.24 |
14.59 |
1.30 |
m |
- |
- |
+ |
+ |
5 |
5.69 |
7.44 |
13.13 |
1.31 |
m |
- |
- |
+ |
+ |
6 |
2.40 |
10.5 |
12.90 |
4.38 |
st |
- |
S |
- |
+ |
7 |
5.07 |
6.59 |
11.66 |
1.30 |
m |
S |
- |
+ |
+ |
8 |
3.94 |
7.15 |
11.09 |
1.82 |
sm |
- |
S |
-,+ |
+ |
m= metacentric; st= subtelomeric; sm= submetacentric; S= site for 5S rDNA
and 45S rDNA on short arm of chromosome. += present; -= absent
Probes designed included Oligo-5S rDNA
labeled red to tag 5S rDNA
and Oligo-18S rDNA
labeled green to tag 45S rDNA as
indicated in Fig. 3a, b. The difference
for the results of ND-FISH and simple FISH
was chromosome were more precise and in good shape in ND-FISH hybridization (Fig. 2 and Fig. 3) compared to the results of simple FISH in which hybridizations were taken place after chromosome
denaturation (Fig. 4).
Fig. 2: Non-denaturing Fluorescence in situ hybridization for sub-telomeric
repeat DNA (Oligo-pAc074) with the labelled with5‘FAM (green signals). Red
arrows indicated for absence of signals on terminal part of chromosome, white arrows indicated the termini with week
signals (a-d). a)
metaphase of MKS-57165, b) metaphase and prophase of Saryab Red, c) metaphase and interphase of Super Sarhad, d) metaphase and prophase of Phulkara. e)
Ideogram of A. cepa
chromosome in descending order
FISH
for telomeric satellite DNA Repeats and 45S
rDNA
In situ
hybridization with probes for the sub-telomeric
satellite DNA repeat and 45S rDNA (Fig. 4) show
sub-terminal hybridization of the satellite (red signals) on all chromosomes
except for the short arm of chromosome 6
where 45S rDNA (green) is hybridized. On the short arm of chromosome 8, there were
strong signals of 45S rDNA (white arrow, Fig. 4a, b,
c, d) on one chromosome, while the other homologue of chromosome 8 hybridized
with satellite (green arrows, Fig. 4a, b); thus co localization of 45S rDNA and
satellite DNA was observed (white arrow, Fig. 4d, e and green arrow, Fig. 4d; also
seen in pro-metaphase, green arrow Fig. 4c; and interphase, green arrow Fig.
4d). The 28 signals for the telomeric
satellite DNA repeats are also seen in interphase nuclei (Fig. 4c, d). Hybridization
of satellite DNA showed almost the same pattern of hybridization sites as
indicated in sub-telomeric tandem repeats above (Fig.
2), and showed that the chromosomal locations in chromosomes 6 and 8 which are
not hybridized either with telomeric repeats or
satellite DNA repeats hybridized with 45S rDNA. It was found that signals for 45S rDNA and sub-telomeric repeats with
ND-FISH (Fig. 3) were similar to the signals observed by simple or denaturing FISH (Fig. 4).
Fig. 3: Non-denaturing Fluorescence in situ hybridization for sub-telomeric repeat DNA with the Oligo-pAc074 probe (c, d) that is labelled
with5‘FAM (green signals). Oligo-5S rDNA labeled red (indicated white arrows) and Oligo-18S rDNA labeled green (indicated by white arrow heads) in
Fig-3a, b. Chromosome spread of MKS-57165 with 5s and 45S rDNA
signals (a) and Oligo-pAc074 (c). Chromosome spread of Saryab
Red with 5s and 45S rDNA signals (b) and Oligo-pAc074 (d). Counter staining was performed by Propidium iodide (red)
Fig. 4: Dual colour FISH for telomeric satellite DNA and 45S rDNA. Telomeric
satellite DNA labeled with biotin-11-dUTP (red
signals) and 45S rDNA
are labelled with digoxigenin-16-dUTP (green
signals). Counter staining was performed by DAPI. a) metaphase
chromosomes of Saryab Red b) metaphase of
MKS-57165, c) prophase of Super Sarhad, d)
metaphase and prophase of Phulkara
Discussion
Using an in
situ hybridization protocol without a step for denaturing
DNA, termed non-denaturing or ND-FISH, a comparative study of
sub-telomeric tandem repeats (Oligo-pAc074) a sub-telomeric
satellite DNA clone, and the 45S rDNA sequence as probes
showed their locations at the sub-terminal regions (seen in micrographs Fig. 1–4)
of chromosomes of accessions of onion. Surprisingly similar pictures were
obtained with and without the chromosomal denaturation step, indicating that
other steps in the protocol were making the DNA accessible to the probes,
and/or the probes were displacing sequences on chromosomes. The chromosome
analysis and karyotype formula for onion (variety Eumjinara)
are similar to those in variety Sinseonhwang (Mancia et al.
2015). Nevertheless, one significant polymorphism was found here (Fig. 3),
perhaps surprising in commercial seed where inbreeding would be expected.
Polymorphism for microsatellite was also observed in A
genome (Triticum dicoccoides) of wheat by Adonina et al.
(2015).
As for as
results of the sub-telomeric satellite DNA and its
association with 45S rDNA is concerned, in all
the studied metaphases and interphases of A.
cepa chromosomes it was observed that ends of
short arm of chromosome 6 (NOR
chromosome) did not show signals for satellite DNA (Fig. 4, with red arrows). A
similar observation was found in case of sub-telomeric
tandem repeats (Fig. 1). However, these ends of short arms hybridized and
showed strong signals for 45S rDNA as indicated with red
arrows (Fig. 3a, b and Fig. 4).
As from the
studies of Peška et al.
(2019), there was similarity between the sequences of Oligo-pAc074 and the sub-telomeric satellite DNA repeats with some
deletions, a few insertions and having differences in some single nucleotide
positions. The present study revealed that there are no sub-telomeric
tandem or satellite repeats on the distal end of short arm of chromosome 6, supporting the results of Pich and Schubert (1998) and Do et al. (2001) by using GC rich telomeric
satellite DNA repeats and tandem repeat sequences. They found signals at all
termini except for nuclear organizing (NOR) chromosome 6, whose short arm did not hybridize with the telomeric
satellite. They also concluded that this sub-telomeric
satellite also intermixed with 45S rDNA. In the present study
very weak signals of sub-telomeric satellite DNA were
observed on terminal of the short arm of one homologue of chromosome 8 (Fig. 2,
white and green arrows), however, in interphase these signals are comparatively
prominent (Fig. 4d), most likely due to the elongation of the chromosomes and
separation of arrays of rDNA from the satellite.
Similar results were observed for the telomeric
sequence in potato by Torres et al.
(2011). Weak signals are attributed to the low copy number of available
sequences that might be beyond the detection limit of routinely used FISH
techniques, although can also be due to lower homology of the probe to a
high-copy target. Torres et al.
(2011) also found a great variability for copy number of these telomeric repeats at different ends of chromosomes in
potato. Fajkus et al.
(2005) demonstrated that all termini in Allium
are not same and there is a variable distribution of rDNA
sequences at these positions. Barnes et al.
(1985) identified this abundant sub-telomeric
satellite DNA sequence (375 bp) in cultivated onion and found similar results with 30 termini (ends of
15
chromosomes) hybridizing with this satellite DNA. Mancia et al.
(2015) studied dual colour FISH and observed that all
30 termini were hybridized with sub-telomeric
satellite repeats with very low copy number on chromosome 8, except for 2
termini of short arm of NOR-Chromosome (chromosome 6) that hybridized with 45S rDNA. All these studies verified our results for tandem
repeats or sub-telomeric satellite DNA and 45S rDNA using ND-(FISH) methodology. Li et al. (2012) studied the
linkage of telomeres and rDNA with chromosome in Chrysanthemum segetum
L. by double-target FISH. It was found that sub-telomeric
repeats are interspersed with 45S rDNA sequences. Lakshmanan et al.
(2015) studied karyotypes of members of Araceae and
found that 45S rDNA was located near intercalary position of short arm of chromosome. Pich et al.
(1996) concluded that instead of protecting the integrity of DNA these rDNA loci developed ‘bridges’ between both the chromosome
of nuclear organization region (sometimes with the satellite distant from the
remaining chromosome, so it is wrongly considered a supernumerary or B-chromosome)
and can produce recombination for terminal sequences. Dvořáčková et al.
(2015) suggested that both telomeres and rDNA
are a source to maintain the integrity of genome and its stability, although it
is now clear that the stability of chromosome termini in Allium comes
from enzymatic addition of a modified telomeric
oligomer (Fajkus et
al. 2016). Detailed investigation of sub-telomeric
tandem repeats, telomeric satellite DNA coupled with
45S rDNA is useful to understand the complexity and
organization of the large onion genome, and the maintenance of genome
integrity.
ND-FISH is a fast, simple and efficient technique as it reduces
hybridization time up to one hour and also potentially maintains chromosome morphology
by omitting the
denaturation step (Fu et
al. 2015; Zhu et al.
2017) and variation in the time and
temperature of denaturation that may need to be optimized, often depending on
length and conditions of storage of fixations and preparations. ND-FISH for
physical location of repetitive sequences was relatively successful on
cytogenetic investigation among wheat and related species (Tang et al. 2016; Lang et al. 2019). Lang et al. (2019) also mentioned in their studies that the results that were unobtainable by simple FISH probes were obtained by ND-FISH by quoting the results of Oligo-3A1 signals on 3A chromosome of
wheat. After successful comparison
between FISH and ND-FISH in current study it was found that the ND-FISH results
for Oligo-5S rDNA, Oligo-18S rDNA
(Fig. 3a, b) and Oligo-pAc074 (Fig. 2, Fig. 3c, d) were similar to that of FISH
patterns of telomeric satellite DNA probe and 45S rDNA (Fig. 4), suggesting that ND-FISH methods coupled with
oligonucleotides can replace the use of cloned or amplified repetitive sequence
probes for FISH in onion chromosome identification. Oligonucleotide probes may be developed
for high-throughput and precise chromosome identification and evolutionary
studies (Jiang 2019), but
require large tracts of chromosomal DNA sequence that are not available in
onion. ND-FISH is
convenient and reliable, with the fluorochrome
labeled oligonucleotides being extremely convenient and relatively cheap to
purchase (Fu et al. 2015) compared to
labelled nucleotides, labelling
enzymes and probe purification systems. PCR labelling
is less reliable, although in combination with oligonucleotide probes in
ND-FISH is clearly beneficial for plant cytogenetics,
providing new information about some less explored repeats from the species of
interest with huge genomes.
Conclusion
ND-FISH results, omitting a denaturation step for
chromosomes before hybridizations, for Oligo-pAc074 (Fig. 2), Oligo-5S rDNA and Oligo-18S rDNA (Fig. 3a,
b) were similar to that of FISH patterns following denaturation, showing the
sub-telomeric satellite DNA and NOR (45S rDNA) locations (Fig. 4), suggesting that ND-FISH methods
by oligonucleotides can be used for FISH in onion chromosome identification.
The fast and low-cost ND-FISH for physical location of repetitive sequences was
successful for cytogenetic investigations among wheat and related species (Fu et
al. 2015; Tang et al. 2016; Lang et al. 2019). As in many
other species (Galasso et al. 1995; Osuji et al. 1998), even in recent years with
availability of high-throughput DNA sequences, particularly in work with
species like Allium with larger genomes, in situ hybridization
enables chromosome identification, including discovery of heteromorphisms
(Fig. 4) and evolutionary rearrangements between species of potential value in
making wide hybrids for introduction of novel genetic variation from wild
species into cultivated onion. It is likely that the fast, simple ND-FISH with
oligonucleotide probes can be effectively used for Allium germplasm identification in larger
collections and populations.
Acknowledgements
Authors are grateful to the Higher Education Commission
(HEC) of Pakistan for providing funds to carry out the experiments and the
University of Leicester, UK for providing laboratory
facilities to conduct FISH experiment.
Author Contributions
J. S. (Pat) Heslop‐Harrison, Zujun
Yang, M. Kausar Nawaz and Nadeem
Khan design the study. Rafiq Ahmad and Guangrong Li performed the experiments. J. S. (Pat) Heslop‐Harrison,
Rafiq Ahmad and Nadeem Khan
analyzed the data. Rafiq Ahmad, Mahmood
Ul Hassan, Sadia Saeed and Danish Ibrar
wrote the manuscript. All authors have read and approved the manuscript.
References
Adonina IG, NP Goncharov, ED Badaeva, EM Sergeeva, NV Petras, EA Salina (2015).
(GAA)n microsatellite as an indicator of
the A genome reorganization during wheat evolution and domestication. Compar Cytogenet 9:533‒547
Barnes SR, AM
James, G Jamieson (1985). The organisation,
nucleotide sequence, and chromosomal distribution of a satellite DNA from Allium cepa.
Chromosoma
92:185‒192
Chang KD, SA Fang, FC Chang, MC Chung (2010).
Chromosomal conservation and sequence diversity of ribosomal RNA genes of two
distant Oryza
species. Genomics 96:181‒190
Cuadrado Á, H Golczyk, N Jouve (2009). A novel, simple and rapid nondenaturing
FISH (ND-FISH) technique for the detection of plant telomeres. Potential
used and possible target structures detected. Chromosome Res 17:755‒762
Do GS, BB Seo,
M Yamamoto, G Suzuki, Y Mukai (2001). Identification and chromosomal location of tandemly
repeated DNA sequences in Allium cepa. Genes
Genet Syst 76:53‒60
Doyle JJ, JL Doyle (1990). Isolation of plant DNA from fresh tissue. Focus 12:39‒40
Dvořáčková M, M Fojtová, J Fajkus (2015). Chromatin dynamics of plant telomeres and ribosomal genes. Plant J 83:18‒37
Fajkus J, E Sýkorová, AR Leitch (2005). Telomeres in
evolution and evolution of telomeres. Chromosome Res 13:469‒479
Fajkus P,
V Peška, Z Sitová, J Fulnečková, M Dvořáčková,
R Gogela, E Sýkorová, J Hapala, J Fajkus (2016). Allium telomeres unmasked: The unusual telomeric sequence (CTCGGTTATGGG) n is synthesized by
telomerase. Plant J 85:337‒347
Fu S, L Chen, Y Wang, M Li, Z Yang, L Qiu, B Yan, Z Ren, Z Tang (2015).
Oligonucleotide probes for ND-FISH analysis to identify rye and wheat
chromosomes. Sci Rep 5:1‒7
Fuchs J, A Brandes,
I Schubert (1995). Telomere sequence localization and karyotype evolution in
higher plants. Plant Syst Evol
196:227‒241
Galasso I, T Schmidt, D Pignone, JS Heslop-Harrison (1995).
The molecular cytogenetics of Vigna unguiculata
(L.) Walp: The physical organization and
characterization of 18s-5.8s-25s rRNA genes, 5s rRNA genes, telomere-like sequences, and a family of centromeric repetitive DNA sequences. Theor Appl Genet 91:928‒935
Gomez-Rodriguez VM, B Rodriguez-Garay, G Palomino, J Martínez, R Barba-Gonzalez (2013). Physical mapping
of 5S and 18S ribosomal DNA in three species of Agave (Asparagales,
Asparagaceae). Compar
Cytogenet 7:191‒203
Hizume M, F Shibata, Y Matsusaki, Z Garajova (2002). Chromosome identification and comparative karyotypic
analyses of four Pinus species. Theor Appl Genet 105:491‒497
Jiang J (2019). Fluorescence in situ
hybridization in plants: Recent developments and future applications. Chromosome Res 9:153–165
Katsiotis A, M Loukas, JS Heslop-Harrison (2000).
Repetitive DNA, genome and species relationships in Avena and Arrhenatherum
(Poaceae). Ann
Bot 86:1135‒1142
Kilian AN,
C Stiff, A Kleinhofs (1995). Barley telomeres
shorten during differentiation but grow in callus culture. Proc Natl Acad Sci 92:9555‒9559
Kubis S, JS Heslop-Harrison, T Schmidt (1997). A family of
differentially amplified repetitive DNA sequences in the genus Beta reveals genetic variation in Beta
vulgaris subspecies and cultivars. J Mol 44:310‒320
Lakshmanan PS, KV Laere, T Eeckhaut, JV Huylenbroeck, EV Bockstaele, L Khrustaleva (2015). Karyotype analysis and visualization of
45S rRNA genes using fluorescence in situ
hybridization in aroids (Araceae). Compar Cytogenet 9:145‒160
Lang T, G Li, H Wang, Z Yu, Q Chen, E
Yang, S Fu, Z Tang, Z Yang (2019). Physical location of tandem repeats in the
wheat genome and application for chromosome identification. Planta 249:663‒675
Levan A, K Fredga, AA Sandberg (1964). Nomenclature
for centromeric position on chromosomes. Hereditas 52:201‒220
Li J, S He, L
Zhang, Y Hu, F Yang, L Ma, J Huang, L Li (2012). Telomere and 45S rDNA sequences are structurally linked on the chromosomes
in Chrysanthemum segetum
L. Protoplasma 249:207‒215
Liu Q, X Li, X
Zhou, M Li, F Zhang, T Schwarzacher, JS Heslop-Harrison (2019). The repetitive
DNA landscape in Avena (Poaceae): Chromosome and genome
evolution defined by major repeat classes in whole-genome sequence reads. BMC Plant Boil 19; Article 226
Malik A, A Srivastava
(2009). Karyotypic analysis of different populations of Carthamus tinctorius Linnaeus (Asteraceae).
Compar Cytogenet 3:51‒55
Mancia FH, SH Sohn, YK Ahn, DS Kim, JS Kim, YS
Kwon, CW Kim, TH Lee, YJ Hwang (2015). Distribution of various types of
repetitive DNAs in Allium cepa L. based on dual color FISH. Hortic Environ Biotechnol 56:793‒799
McClintock B (1941). The
stability of broken ends of chromosomes in Zea mays. Genetics
26:234–282
Müller HJ (1938). The
remaking of chromosomes. Collect Net 13:181‒198
Nascimento
EFD, BVD Santos, LO Marques, PM Guimarăes, AC Brasileiro, SC Leal-Bertioli, DJ Bertioli, AC Araujo (2018). The genome structure of Arachis hypogaea (Linnaeus, 1753) and an induced Arachis allotetraploid revealed by molecular cytogenetics.
Compar Cytogenet
12:111‒140
O'Connor C (2008). Telomeres of human chromosomes. Nat Educ 1:166
Osuji JO, J Crouch, G
Harrison, JS Heslop-Harrison (1998). Molecular cytogenetics of Musa species, cultivars and hybrids: Location
of 18S-5.8 S-25S and 5S rDNA and telomere-like
sequences. Ann Bot 82:243‒248
Peška V, T Mandáková, V Ihradská, J Fajkus (2019). Comparative Dissection of Three Giant
Genomes: Allium cepa,
Allium sativum,
and Allium ursinum.
Intl J Mol
20:733–757
Pich U, I Schubert (1998).
Terminal heterochromatin and alternative telometric
sequences in Allium cepa.
Chromosome Res 6:315‒322
Pich U, J Fuchs, I
Schubert (1996). How do Alliaceae stabilize their
chromosome ends in the absence of TTTAGGG sequences? Chromosome Res 4:207‒213
Richards EJ, FM Ausubel
(1988). Isolation of a higher eukaryotic telomere from Arabidopsis thaliana. Cell 53:127‒136
Riha K, J Fajkus, J Siroky, B Vyskot (1998). Developmental control of
telomere lengths and telomerase activity in plants. Plant Cell 10:1691‒1698
Schwarzacher T, JS Heslop-Harrison (1991). In situ
hybridization to plant telomeres using synthetic oligomers. Genome 34:317‒323
Schwarzacher T, P
Heslop-Harrison (2000). Practical in situ hybridization. BIOS
Scientific Publishers Ltd.
Siroky J, J Zluvova, K Riha, DE Shippen, B Vyskot (2003). Rearrangements of ribosomal DNA clusters in late generation
telomerase-deficient Arabidopsis. Chromosoma 112:116‒123
Tang S, L Qiu,
Z Xiao, S Fu, Z Tang (2016). New Oligonucleotide Probes
for ND-FISH Analysis to
Identify Barley Chromosomes and to Investigate Polymorphisms of Wheat Chromosomes. Genes 7:118–117
Torres GA, Z Gong, M Iovene, CD Hirsch, CR Buell, GJ Bryan, P Novák, J Macas, J Jiang (2011).
Organization and evolution of subtelomeric satellite
repeats in the potato genome. G3 Genes
Genomics Genet 1:85‒92
Vershinin AV, T Schwarzacher, JS Heslop-Harrison (1995).
The large-scale genomic organization of repetitive DNA
families at the telomeres of rye chromosomes. Plant Cell 7:1823‒1833
Watson, J Matthew,
K Riha (2010). Comparative biology of telomeres: Where
plants stand. FEBS Lett 584:3752‒3759
Zhu M, P Du, L Zhuang,
C Chu, C Zhao, Z Qi (2017). A simple
and efficient non-denaturing FISH method for maize chromosome differentiation
using single-strand oligonucleotide probes. Genome 60:657‒664